Synthetic guide sequence to generate CRISPR-Cas9 entry strains inC. elegans

CRISPR/Cas9 genome editing has become an important and routine method inC. elegansresearch to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically. One solution to this problem is to create an intermediate entry strain using the efficient and well-characteriseddpy-10guide RNA sequence. This “d10 entry strain” can then be used to generate your knock-in of interest. However, thedpy-10sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked todpy-10on LGII or if you want to use thedpy-10as a co-CRISPR marker for the creation of the entry strain then you can not use thedpy-10sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in theC. elegansgenome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed withd10entry strains, it is still sufficient for most applications. This guide sequence can be added to theC. elegansCRISPR toolkit and is particularly useful for generating entry strains where the standarddpy-10guide sequence is not suitable.